Biology, Pages 82-91Neil Campbell and Jane Reece's BIOLOGY remains unsurpassed as the most successful majors biology textbook in the world. This text has invited more than 4 million students into the study of this dynamic and essential discipline.The authors have restructured each chapter around a conceptual framework of five or six big ideas. An Overview draws students in and sets the stage for the rest of the chapter, each numbered Concept Head announces the beginning of a new concept, and Concept Check questions at the end of each chapter encourage students to assess their mastery of a given concept. & New Inquiry Figures focus students on the experimental process, and new Research Method Figures illustrate important techniques in biology. Each chapter ends with a Scientific Inquiry Question that asks students to apply scientific investigation skills to the content of the chapter. |
From inside the book
Results 1-3 of 74
Page 18
... share a common ancestor at a relatively recent branch point on the tree of life . But through an ancestor that lived much farther back in time , finches are related to sparrows , hawks , penguins , and all other birds . And birds ...
... share a common ancestor at a relatively recent branch point on the tree of life . But through an ancestor that lived much farther back in time , finches are related to sparrows , hawks , penguins , and all other birds . And birds ...
Page 39
... share or transfer valence electrons . These interac- tions usually result in atoms staying close together , held by attractions called chemical bonds . The strongest kinds of chemical bonds are covalent bonds and ionic bonds . Covalent ...
... share or transfer valence electrons . These interac- tions usually result in atoms staying close together , held by attractions called chemical bonds . The strongest kinds of chemical bonds are covalent bonds and ionic bonds . Covalent ...
Page 495
... share a distant common ancestor with bacteria . ACGGATAGTCCACTAGGCACTA TCACCGACAGGTCTTTGACTAG △ Figure 25.7 A molecular homoplasy . These two DNA sequences from organisms that are not closely related coincidentally share 25 % of their ...
... share a distant common ancestor with bacteria . ACGGATAGTCCACTAGGCACTA TCACCGACAGGTCTTTGACTAG △ Figure 25.7 A molecular homoplasy . These two DNA sequences from organisms that are not closely related coincidentally share 25 % of their ...
Contents
Featured Figures | 4 |
The Culture of Science | 25 |
The Chemical Context of Life | 32 |
Copyright | |
96 other sections not shown
Other editions - View all
Common terms and phrases
active algae allele amino acid animals atoms bacteria binding biology bonds called Calvin cycle cancer carbon cell division cell's cellular cellular respiration Chapter chemical chloroplasts chromatids chromosome clade cloning codon color complex Concept Check cytoplasm diploid disease diversity electron embryo energy environment enzyme eukaryotic eukaryotic cells evolution evolutionary evolved example Figure flowers fossil function fungi gametes gametophytes genes genetic genome genotype glucose glycolysis haploid human hydrogen inherited ions meiosis metabolic microtubules mitochondria mitosis molecular mRNA multicellular mutations natural selection nucleotides nucleus occur offspring organelles organisms oxygen pathways phage phenotype phosphorylation photosynthesis plasma membrane plasmid polymerase polypeptide population produce prokaryotes protein protists reaction receptor recombination replication reproductive researchers respiration result ribosomes scientists seed sequence sexual signal species sperm spores sporophyte strand structure sugar suggested answers synthesis tion tissue traits transcription transport University vascular plants viral viruses zygote