PCR Cloning ProtocolsBing-Yuan Chen, Harry W. Janes PCR Cloning Protocols, Second Edition, updates and expands Bruce White's best-selling PCR Cloning Protocols (1997) with the newest procedures for DNA cloning and mutagenesis. Here the researcher will find readily reproducible methods for all the major aspects of PCR use, including PCR optimization, computer programs for PCR primer design and analysis, and novel variations for cloning genes of special characteristics or origin, with emphasis on long distance PCR and GC-rich template amplification. Also included are both conventional and novel enzyme-free and restriction site-free procedures to clone PCR products into a range of vectors, as well as state-of-the-art protocols to facilitate DNA mutagenesis and recombination, and to clone the challenging uncharacterized DNA flanking a known DNA fragment. |
From inside the book
Results 1-5 of 78
Page 9
... region and that the impurities associated with the target be adequately dilute so as to not inhibit enzyme activity. However, for some amplifi- cations, such as long PCR, it may be necessary to consider the quality and quantity of the ...
... region and that the impurities associated with the target be adequately dilute so as to not inhibit enzyme activity. However, for some amplifi- cations, such as long PCR, it may be necessary to consider the quality and quantity of the ...
Page 13
... region of HIV-1 using the AmpliTaq Gold Hot Start process. 1. 10X PCR Buffer II: 100 mm Tris-KCl, 500 mM KCl, pH 8.3 at room temperature. 2. 25 mM MgCl2 solution. 3. dNTPs: 10 mM stocks of each of dATP, dCTP, dGTP; 20 mM stock of dUTP ...
... region of HIV-1 using the AmpliTaq Gold Hot Start process. 1. 10X PCR Buffer II: 100 mm Tris-KCl, 500 mM KCl, pH 8.3 at room temperature. 2. 25 mM MgCl2 solution. 3. dNTPs: 10 mM stocks of each of dATP, dCTP, dGTP; 20 mM stock of dUTP ...
Page 25
... 59.83 50.00 4.00 2.00 ttgcactctcatcccaagtg SEQUENCE SIZE : 1824 INCLUDED REGION SIZE : 1824 PRODUCT SIZE : 201 , PAIR ANY COMPL : 7.00 , PAIR 3 ' COMPL : 3.00 3.1.2 . Design Primers with User - Defined Settings Often PCR Primer Design 25 ...
... 59.83 50.00 4.00 2.00 ttgcactctcatcccaagtg SEQUENCE SIZE : 1824 INCLUDED REGION SIZE : 1824 PRODUCT SIZE : 201 , PAIR ANY COMPL : 7.00 , PAIR 3 ' COMPL : 3.00 3.1.2 . Design Primers with User - Defined Settings Often PCR Primer Design 25 ...
Page 26
... region in DNA.txt , which is from nucleotide 71 to 1636 . 1. Start a web browser ( Netscape or Internet Explorer ) . 2. Replace the default URL address with http://www-genome.wi.mit.edu/cgibin/primer/ primer3_www.cgi and hit return ...
... region in DNA.txt , which is from nucleotide 71 to 1636 . 1. Start a web browser ( Netscape or Internet Explorer ) . 2. Replace the default URL address with http://www-genome.wi.mit.edu/cgibin/primer/ primer3_www.cgi and hit return ...
Page 38
You have reached your viewing limit for this book.
You have reached your viewing limit for this book.
Contents
19 | |
31 | |
Lori A Kolmodin | 37 |
Coupled OneStep Reverse Transcription and Polymerase Chain | 53 |
Long Distance ReverseTranscription | 59 |
from ParaffinEmbedded Tissues | 67 |
Teruaki Tozaki 10 MethylationSpecific PCR | 81 |
Haruhiko Ohashi | 91 |
A Fast Polymerase Chain ReactionMediated Strategy for Introducing | 217 |
PCR Screening in SignatureTagged Mutagenesis of Essential Genes | 225 |
Staggered Extension Process StEP In Vitro Recombination | 235 |
PCRBased Strategies to Clone Unknown DNA Regions | 249 |
Long Distance Vectorette PCR LDV PCR | 275 |
Nonspecific Nested Suppression PCR Method | 285 |
cDNA Cloning | 293 |
Genomic DNA Cloning | 301 |
Contents | 99 |
Contents ix | 103 |
CLONING PCR PRODUCTS | 111 |
Using T4 DNA Polymerase to Generate Clonable PCR Products | 121 |
Directional Restriction SiteFree Insertion of PCR Products | 133 |
A Rapid and Simple Procedure for Direct Cloning | 153 |
MUTAGENESIS AND RECOMBINATION | 167 |
InFrame Cloning of Synthetic Genes Using PCR Inserts | 175 |
Megaprimer | 189 |
PCR Method for Generating Multiple Mutations at Adjacent Sites | 207 |
Gene Cloning and Expression Profiling by Rapid Amplification | 309 |
The Isolation of DNA Sequences Flanking Tn5 Transposon Insertions | 315 |
Rapid Amplification of Genomic DNA Sequences Tagged | 325 |
by Anchored | 337 |
A Step Down PCRBased Technique for Walking | 343 |
Cloning of Homologous Genes by GeneCapture | 359 |
Rapid and Nonradioactive Screening of Recombinant Libraries by | 377 |
Generation and PCR Screening of Bacteriophage λ Sublibraries | 391 |
A 384Well MicrotiterPlateBased Template Preparation | 411 |
Other editions - View all
Common terms and phrases
Acids Res agarose gel electrophoresis aliquot amplicons analysis annealing temperature approx AS-PCR baculovirus BioTechniques blunt-end cDNA cells centrifuge cloning method cloning of PCR coli concentration containing denaturation digestion direct cloning DNA fragments DNA ligase DNA sequence dNTP double-stranded EDTA efficiency ethanol ethidium bromide flanking full-length genomic DNA H. W. Janes hybridization in-frame cloning Incubate insert inverse PCR IPCR isolation known sequence ligation reaction megaprimer Meth MgCl2 mixture mutagenesis mutations Note Nucl nucleotide oligonucleotide PCR amplification PCR buffer PCR Cloning Protocols PCR primers PCR products plasmid plasmid DNA plate polymerase chain reaction primer primer design probe protein purified Qiagen reagents recombination region restriction endonuclease restriction enzyme restriction sites room temperature sample screening single-stranded specific step sterile strand strategy Subheading synthesis Taq DNA polymerase Taq polymerase target technique template thermal cycler tion transposon Tris-HCl tube virus vitro