Molecular Cloning: A Laboratory Manual, Volume 1 |
From inside the book
Results 1-3 of 46
Page 2-33
... polycloning - site sequence is GGATCTGGGTCGACGGATCCGGGGAATTCCCAGATCC JL Sall BamHI EcoRI In EMBL3 and EMBL3A , the polycloning sites and stuffer are as shown in the EMBL3A map : Sall , BamHI , EcoRI - stuffer - EcoRI , BamHI , Sall . In ...
... polycloning - site sequence is GGATCTGGGTCGACGGATCCGGGGAATTCCCAGATCC JL Sall BamHI EcoRI In EMBL3 and EMBL3A , the polycloning sites and stuffer are as shown in the EMBL3A map : Sall , BamHI , EcoRI - stuffer - EcoRI , BamHI , Sall . In ...
Page 2-35
... polycloning sites . These bac- teriophages have bacteriophage T7 and T3 promoters in the polycloning sites . Thus , RNA probes can be synthesized without subcloning , and chromosome walking is made easier . λ2001 A2001 contains multiple ...
... polycloning sites . These bac- teriophages have bacteriophage T7 and T3 promoters in the polycloning sites . Thus , RNA probes can be synthesized without subcloning , and chromosome walking is made easier . λ2001 A2001 contains multiple ...
Page 2-37
... polycloning - site sequences are inverted with respect to one another . Inserts that destroy the XhoI or BamHI site can be excised at flanking sites . The bacteriophage T3 and T7 promoters adjacent to the polycloning sites allow RNA ...
... polycloning - site sequences are inverted with respect to one another . Inserts that destroy the XhoI or BamHI site can be excised at flanking sites . The bacteriophage T3 and T7 promoters adjacent to the polycloning sites allow RNA ...
Contents
DEVELOPMENT OF PLASMID CLONING VECTORS | 1-7 |
Constructing Expression Libraries in Plasmid and Bacteriophage | 1-12 |
Expression Libraries Constructed in Bacteriophage 12 | 1-19 |
Copyright | |
96 other sections not shown
Other editions - View all
Common terms and phrases
agar plate agarose gel aliquots amber mutations ampicillin antibiotic bacteriophage particles bacteriophage T4 bacteriophage T4 DNA BamHI Bgill buffer carrying cDNA cells cloning coli cosmid cosmid vector culture digestion DNA fragments DNA ligase DNA molecules DNA polymerase double-stranded DNA EcoRI EDTA EDTA pH 8.0 efficiency Escherichia coli ethanol ethidium bromide eukaryotic eukaryotic DNA exonuclease extracts foreign DNA formamide gene genetic HindIII Hindill host hours at 37°C hybridization Incubate infected inserted Kpnl lacZ ligation reaction linear lysogenic method microfuge tube minutes at 4°C nin5 nitrocellulose nitrocellulose filter Nucleic Acids nucleotides packaging pasteur pipette pellet plaques plasmid DNA plasmid vectors polycloning prepared probes protein purified Pvul recA red gam remove replication restriction enzyme RNAase room temperature Sacl Sall sequences Smal solution sterile stored strains strand stuffer supernatant T4 DNA ligase teriophage transfer transformation Tris Cl pH vector DNA vitro volume Xbal µg/ml