Molecular Cloning: A Laboratory Manual, Volume 1 |
From inside the book
Results 1-3 of 51
Page 2-33
... polycloning - site sequence is GGATCTGGGTCGACGGATCCGGGGAATTCCCAGATCC Sall BamHI EcoRI In EMBL3 and EMBL3A , the polycloning sites and stuffer are as shown in the EMBL3A map : Sall , BamHI , EcoRI - stuffer - EcoRI , BamHI , Sall . In ...
... polycloning - site sequence is GGATCTGGGTCGACGGATCCGGGGAATTCCCAGATCC Sall BamHI EcoRI In EMBL3 and EMBL3A , the polycloning sites and stuffer are as shown in the EMBL3A map : Sall , BamHI , EcoRI - stuffer - EcoRI , BamHI , Sall . In ...
Page 2-35
... polycloning sites . These bac- teriophages have bacteriophage T7 and T3 promoters in the polycloning sites . Thus , RNA probes can be synthesized without subcloning , and chromosome walking is made easier . λ2001 A2001 contains multiple ...
... polycloning sites . These bac- teriophages have bacteriophage T7 and T3 promoters in the polycloning sites . Thus , RNA probes can be synthesized without subcloning , and chromosome walking is made easier . λ2001 A2001 contains multiple ...
Page 2-37
... polycloning - site sequences are inverted with respect to one another . Inserts that destroy the XhoI or BamHI site can be excised at flanking sites . The bacteriophage T3 and T7 promoters adjacent to the polycloning sites allow RNA ...
... polycloning - site sequences are inverted with respect to one another . Inserts that destroy the XhoI or BamHI site can be excised at flanking sites . The bacteriophage T3 and T7 promoters adjacent to the polycloning sites allow RNA ...
Contents
Essential Features of Plasmids 1 | 1-3 |
Staininging RNA Before and After Transfer to Nitrocellulose Filters 7 51 | 1-7 |
Index | 1-8 |
Copyright | |
95 other sections not shown
Other editions - View all
Common terms and phrases
activity agar agarose aliquots allow amount appropriate arms bacterial bacteriophage BamHI buffer carrying cells centrifugation Chapter cloning coli colonies competent concentration construction containing cosmid culture described digestion EcoRI efficiency electrophoresis et al ethanol ethidium ethidium bromide extracts Figure filters final foreign DNA fragments gene genetic genome gradients growth Hindill host hybridization Incubate infected inserted libraries ligase ligation linear method microfuge minutes minutes at 4°C mixture molecules mutations Nucleic Acids obtained original packaging pellet plaques plasmid DNA plate polycloning polymerase possible precipitate prepared presence probes procedure protein purified Pvul reaction recA recombinant Recover region remove replication restriction enzyme resulting room temperature Sall screening segment selection sequences single single-stranded Smal solution step sterile stored strains strand supernatant termini transfer transformation tube usually vector volume yield