Molecular Cloning: A Laboratory Manual, Volume 1 |
From inside the book
Results 1-3 of 48
Page 2-33
... polycloning - site sequence is GGATCTGGGTCGACGGATCCGGGGAATTCCCAGATCC Sall BamHI EcoRI In EMBL3 and EMBL3A , the polycloning sites and stuffer are as shown in the EMBL3A map : SalI , BamHI , EcoRI - stuffer - EcoRI , BamHI , SalI . In ...
... polycloning - site sequence is GGATCTGGGTCGACGGATCCGGGGAATTCCCAGATCC Sall BamHI EcoRI In EMBL3 and EMBL3A , the polycloning sites and stuffer are as shown in the EMBL3A map : SalI , BamHI , EcoRI - stuffer - EcoRI , BamHI , SalI . In ...
Page 2-35
... polycloning sites . These bac- teriophages have bacteriophage T7 and T3 promoters in the polycloning sites . Thus , RNA probes can be synthesized without subcloning , and chromosome walking is made easier . λ2001 A2001 contains multiple ...
... polycloning sites . These bac- teriophages have bacteriophage T7 and T3 promoters in the polycloning sites . Thus , RNA probes can be synthesized without subcloning , and chromosome walking is made easier . λ2001 A2001 contains multiple ...
Page 2-37
... polycloning - site sequences are inverted with respect to one another . Inserts that destroy the XhoI or BamHI site can be excised at flanking sites . The bacteriophage T3 and T7 promoters adjacent to the polycloning sites allow RNA ...
... polycloning - site sequences are inverted with respect to one another . Inserts that destroy the XhoI or BamHI site can be excised at flanking sites . The bacteriophage T3 and T7 promoters adjacent to the polycloning sites allow RNA ...
Contents
BOOK | 1-2 |
DEVELOPMENT OF PLASMID CLONING VECTORS | 1-7 |
Index | 1-8 |
Copyright | |
84 other sections not shown
Other editions - View all
Common terms and phrases
agar agarose gel aliquots amber mutations bacteria bacteriophage M13 bacteriophage particles bacteriophage T4 bacteriophage T4 DNA BamHI Bgill buffer cDNA cells centrifugation at 12,000g cleaved cloning coli DNA polymerase colonies containing cosmid cosmid vector culture digestion DNA fragments DNA ligase DNA molecules DNA polymerase double-stranded DNA EcoRI EDTA efficiency Escherichia coli ethanol ethidium bromide eukaryotic eukaryotic DNA exonuclease extracts foreign DNA gel electrophoresis gene genetic Gp Cp HindIII Hindill host hybridization Incubate infected inserted intergenic region Kpnl lacZ linear lysogenic method methylase methylation microfuge tube minutes at 4°C nin5 nitrocellulose nucleotides origin of replication packaging pellet phagemids plaques plasmid plasmid DNA plate polycloning prepared protein Pvul recA recombinant red gam remove replication restriction enzyme room temperature Sacl Sall single-stranded DNA Smal solution sterile stored strains strand supernatant T4 DNA ligase teriophage Transfer Tris Cl pH vector DNA vitro volume Xbal µg/ml