Molecular Cloning: A Laboratory Manual, Book 3 |
From inside the book
Results 1-3 of 19
Page 1621
... Polycloning site AAGCTAGCCCGGGGTCGACCTCGAGGG JU Smal Sall Xhol Nhel FIGURE 16.3A PMSG is a transient expression vector that uses the mouse mammary tumor virus ( MMTV ) LTR promoter ( PLTR ) to express cDNA sequences cloned into the ...
... Polycloning site AAGCTAGCCCGGGGTCGACCTCGAGGG JU Smal Sall Xhol Nhel FIGURE 16.3A PMSG is a transient expression vector that uses the mouse mammary tumor virus ( MMTV ) LTR promoter ( PLTR ) to express cDNA sequences cloned into the ...
Page 175
... Polycloning Sites lacz EcoRI 2000 1000 PUR278 TGT CAA AAA GGG GAT CCG TCG ACT CTA GAA AGC TTA TCG ATG BamHI Sall ... polycloning sites that allow fusions in each of the three reading frames , and they contain a PstI site in the amp ...
... Polycloning Sites lacz EcoRI 2000 1000 PUR278 TGT CAA AAA GGG GAT CCG TCG ACT CTA GAA AGC TTA TCG ATG BamHI Sall ... polycloning sites that allow fusions in each of the three reading frames , and they contain a PstI site in the amp ...
Page 17-7
... Polycloning site 6000 Polycloning Site Xcl 2000 4000 lac P lac lac lac 5000 UV5 UV5 3000 Leu AAG CCA AGC TTG GGA TCC CCG GGG ATC CGG AGC TTG G CTG HindIII BamHI Smal BamHI FIGURE 17.3 T lacl PMR100 is an ORF vector that carries a lac ...
... Polycloning site 6000 Polycloning Site Xcl 2000 4000 lac P lac lac lac 5000 UV5 UV5 3000 Leu AAG CCA AGC TTG GGA TCC CCG GGG ATC CGG AGC TTG G CTG HindIII BamHI Smal BamHI FIGURE 17.3 T lacl PMR100 is an ORF vector that carries a lac ...
Other editions - View all
Common terms and phrases
Acad acetate acrylamide activity agarose aliquots amount antibody antigen aqueous phase assay autoclaving autoradiographic bacterial bacteriophage T4 DNA BamHI Biol blunt-ended cDNA cell lines centrifugation chloramphenicol chromatography cloned gene coli DNA polymerase column containing culture Dissolve dithiothreitol DNA ligase DNA polymerase dNTPs double-stranded EDTA EDTA pH 8.0 efficiency electrophoresis eluted encoding Escherichia coli ethanol ethidium bromide eukaryotic expression vectors extract gel-loading buffer H₂O hybridization Incubate intensifying screen ligation linkers mammalian cells medium method mg/ml microfuge tube mixture mRNAs NaCl Natl nitrocellulose nitrocellulose filter nucleic acid nucleotides OH OH P.O. Box pellet phosphate pipette plasmid PMSF polycloning precipitation prepared Proc promoter radioactive radiolabeled reaction remove restriction enzyme room temperature sample sequences sodium sterile stock solution stored strain supernatant target protein Telephone termini tion transcription transfection transfer Tris Cl pH vectors washed western blotting µg/ml