PCR Methods and Applications, Volume 4, Issues 1-3Cold Spring Harbor Laboratory Press, 1994 - Gene amplificaiton |
From inside the book
Results 1-3 of 17
Page 3
... Oligonucleotide - based Detection Methods Numerous new methods for detection ... probe format ( Fig . 1 ) the amplicon is de- natured and hybridized to an ... probes , because of sequence variations within the hybridization region . As ...
... Oligonucleotide - based Detection Methods Numerous new methods for detection ... probe format ( Fig . 1 ) the amplicon is de- natured and hybridized to an ... probes , because of sequence variations within the hybridization region . As ...
Page 10
... oligonucleotide probes containing the electrochemiluminescent label , Tris ( 2,2 ' - bipyridine ) -ruthenium ( II ) chelate ( TBR ) . After hybridization , the reaction mixture is mixed with streptavidin - coated magnetic beads that ...
... oligonucleotide probes containing the electrochemiluminescent label , Tris ( 2,2 ' - bipyridine ) -ruthenium ( II ) chelate ( TBR ) . After hybridization , the reaction mixture is mixed with streptavidin - coated magnetic beads that ...
Page 86
TABLE 1 Oligonucleotide Probes and Primers bt - GCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGT Nucleotide sequences were derived from GenBank v . 71 , HCV accession number M58335 . The haptens fluorescein ( fl ) and biotin ( bt ) were used for ...
TABLE 1 Oligonucleotide Probes and Primers bt - GCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGT Nucleotide sequences were derived from GenBank v . 71 , HCV accession number M58335 . The haptens fluorescein ( fl ) and biotin ( bt ) were used for ...
Other editions - View all
Common terms and phrases
agarose gel AGLCR aliquot allele Alu repeats amplicons analysis annealing antibody assay bands buffer cassette cell lines cloning coefficients Cold Spring Harbor containing copy number cycles denatured detection dideoxy digestion diluted DNA fragments DNA polymerase DNA sequence dNTP efficiency electrophoresis enzyme ethidium bromide exon extracted FIGURE fingerprinting first-strand GeneAmp genetic genomic genomic DNA human hybridization incubated isolated lane ligation markers merase MgCl2 molecular mRNA mutations Natl Nucleic Acids Nucleic Acids Res nucleotides oligomer oligonucleotide optimal PCR amplification PCR products PCR reaction performed Perkin-Elmer phage phagemid plasmid polyacrylamide gel polymerase chain reaction polymorphism pool primer probe procedure protein protocol pseudogenes quantitative quence RAPD reagents region replicate restriction reverse transcription ribozyme RT-PCR screening segment sensitivity signal single-stranded Southern blot specific Spring Harbor Laboratory SSCP SSCP component strand Taq polymerase target temperature template tion tissue transfected tube vector vectorette vitro