Gene Cloning: An Introduction |
From inside the book
Results 1-3 of 29
Page 113
... EcoRI Figure 6.4 The pUC plasmids . ( a ) The restriction site cluster in the lacZ ' gene of pUC8 . ( b ) The ... EcoRI M13mp8 о Restriction sites Restrict with BamHI and EcoRI -BamHI Ligate Restrict EcoRI with BamHI and EcoRI -BamHI New ...
... EcoRI Figure 6.4 The pUC plasmids . ( a ) The restriction site cluster in the lacZ ' gene of pUC8 . ( b ) The ... EcoRI M13mp8 о Restriction sites Restrict with BamHI and EcoRI -BamHI Ligate Restrict EcoRI with BamHI and EcoRI -BamHI New ...
Page 117
... EcoRI site of M13mp2 . Note that the Sall restriction sites are also recognized by Accl and Hincll . AATTCCCCGGATCCGTCGACCTGCAGGTCGACGGATCCGGGG GGGGCCTAGGCAGCTGGACGTCCAGCTGCCTAGGCCCCTTAA EcoRI BamHI Pstl BamHI EcoRI Sall Sall Accl Accl ...
... EcoRI site of M13mp2 . Note that the Sall restriction sites are also recognized by Accl and Hincll . AATTCCCCGGATCCGTCGACCTGCAGGTCGACGGATCCGGGG GGGGCCTAGGCAGCTGGACGTCCAGCTGCCTAGGCCCCTTAA EcoRI BamHI Pstl BamHI EcoRI Sall Sall Accl Accl ...
Page 120
... EcoRI BamHI Pstl HindIII Smal Xmal Sall Accl Hincll ( b ) The orientation of the polylinker EcoRI M13mp8 HindIII lacZ ' Hindill EcoRI ( c ) Shuttling DNA from M13mp8 to M13mp9 EcoRI Hindill Hindill Recombinant M13mp8 Restrict ΣΣΣΣΣΣΣΣ ...
... EcoRI BamHI Pstl HindIII Smal Xmal Sall Accl Hincll ( b ) The orientation of the polylinker EcoRI M13mp8 HindIII lacZ ' Hindill EcoRI ( c ) Shuttling DNA from M13mp8 to M13mp9 EcoRI Hindill Hindill Recombinant M13mp8 Restrict ΣΣΣΣΣΣΣΣ ...
Contents
Further reading | 12 |
Manipulation of purified | 56 |
Introduction of DNA into living cells | 88 |
Copyright | |
13 other sections not shown
Other editions - View all
Common terms and phrases
agarose gel amino acid amplified ampR analysis animal antibody antisense autoradiograph bacterial bacteriophage bacterium BamHI base-pairing Biotechnology BRCA1 carried cDNA cell extract cerevisiae cloned gene cloning experiment cloning vectors coded codons coli colonies containing control sequence cosmid culture deletion disease DNA fragment DNA sequencing double-stranded E.coli EcoRI enzyme expression vector foreign gene gel electrophoresis gene cloning gene expression genetic engineering Genetic fingerprinting genomic library host cell human hybridization probing identified infection inserted introns labelled lacZ LEU2 ligated medium method molecular mRNA mutation normal nucleic acid nucleotide nucleotide sequence obtained oligonucleotide organisms PCR product phage particles plaques plasmid polylinker polynucleotide primers problem promoter pUC8 purified recombinant DNA recombinant DNA molecule recombinant protein region replication resistance restriction endonuclease restriction fragment restriction sites result RFLP segment selectable marker single-stranded DNA sticky ends strand synthesis T-DNA techniques template Ti plasmid tion transcription translation trpA types virus viruses vitro yeast